Blastn matches dbj|D10207|RICOSA1

BLASTN Tue Apr 9 16:02:58 EDT 1996

>dbj|D10207|RICOSA1 Rice OSA1 gene for H+-ATPase, complete cds.
            Length = 3053

  Plus Strand HSPs:

 Score = 381 (105.3 bits), Expect = 1.1e-21, Sum P(2) = 1.1e-21
 Identities = 105/141 (74%), Positives = 105/141 (74%), Strand = Plus / Plus

Query: 30210 CATGAGCTAACAGCAGCTGTTTACCTACAAGTTAGTATCGTGAGCCAAGCGCTTATCTTT 30269
             ||  ||||  || | ||||| || || |||||||| | | | |||||||| |||||||||
Sbjct:  2305 CAAAAGCTTGCATCTGCTGTATATCTTCAAGTTAGCACCATCAGCCAAGCTCTTATCTTT 2364

Query: 30270 GTAACAAGGTCGCGAAGCTGGTCATATGTTGAACGTCCTAGCTTCTGGTTGATCTCTGCC 30329
             || |||||||| || |||||||||| | | ||||| ||| ||||     |  ||| ||| 
Sbjct:  2365 GTCACAAGGTCTCGCAGCTGGTCATTTATCGAACGCCCTGGCTTTCTACTTGTCTTTGCT 2424

Query: 30330 TTTTTCATGGCTCAGCTGGTA 30350
             || ||| | || |||||| ||
Sbjct:  2425 TTCTTCGTTGCACAGCTGATA 2445

 Score = 104 (28.7 bits), Expect = 1.1e-21, Sum P(2) = 1.1e-21
 Identities = 28/37 (75%), Positives = 28/37 (75%), Strand = Plus / Plus

Query: 30060 TTTCTTCTGGGCTGCAGAGAGCACTGACTTCTTCTCT 30096
             | |||||||||||||| | |  ||  |||| ||| ||
Sbjct:  2219 TATCTTCTGGGCTGCATACAAGACCAACTTTTTCCCT 2255