Blastn matches gb|T41432|T41432

BLASTN Tue Apr 9 16:02:46 EDT 1996

>gb|T41432|T41432 EST001 Glycine max cDNA clone H22 5' similar to H+- ATPase.
            Length = 434

  Plus Strand HSPs:

 Score = 262 (72.4 bits), Expect = 3.3e-37, Sum P(4) = 3.3e-37
 Identities = 74/101 (73%), Positives = 74/101 (73%), Strand = Plus / Plus

Query: 29004 AGCTCTGTAACCTTCGGGAGGATGCAAGCAAGAGAGCTCATGACATCATTGACAAGTTTG 29063
             | ||||| |||      ||||||| ||| || || | |||||  |  |||||||||||||
Sbjct:    23 ACCTCTGCAACTGCAAAGAGGATGTAAGGAAAAGGGTTCATGGAACGATTGACAAGTTTG 82

Query: 29064 CTGACAGAGGACTTCGTTCTCTTGCTGTTGGCAGACAGGTA 29104
             ||||  | ||||| |||||| | | |||||  ||||||| |
Sbjct:    83 CTGAGCGTGGACTCCGTTCTTTAGGTGTTGCTAGACAGGAA 123

 Score = 252 (69.6 bits), Expect = 3.3e-37, Sum P(4) = 3.3e-37
 Identities = 58/68 (85%), Positives = 58/68 (85%), Strand = Plus / Plus

Query: 29342 GACCAACTTGCCATTGGTAAGGAAACTGGTCGTAGGCTTGGGATGGGCACAAACATGTAT 29401
             || || |||| |||||| || |||||||| || ||| |||||||||| ||||||||||| 
Sbjct:   271 GATCAGCTTGGCATTGGCAAAGAAACTGGCCGAAGGNTTGGGATGGGAACAAACATGTAC 330

Query: 29402 CCATCTTC 29409
             ||||||||
Sbjct:   331 CCATCTTC 338

 Score = 149 (41.2 bits), Expect = 3.3e-37, Sum P(4) = 3.3e-37
 Identities = 41/55 (74%), Positives = 41/55 (74%), Strand = Plus / Plus

Query: 29262 TTGACCCTCCAAGACATGACAGTGCAGAGACAATCAGGCGTGCCCTTGATCTTGG 29316
             | || |||||||| ||||||||||| || || ||||   | || ||  | |||||
Sbjct:   189 TGGATCCTCCAAGGCATGACAGTGCGGAAACCATCACAAGAGCTCTAAACCTTGG 243

 Score = 114 (31.5 bits), Expect = 3.3e-37, Sum P(4) = 3.3e-37
 Identities = 26/30 (86%), Positives = 26/30 (86%), Strand = Plus / Plus

Query: 29313 TTGGTGTTAATGTCAAGATGATCACTGGTG 29342
             | ||||| ||||| ||||||||||| ||||
Sbjct:   241 TGGGTGTGAATGTTAAGATGATCACCGGTG 270