Blastn matches gb|T76642|T76642

BLASTN Tue Apr 9 16:02:46 EDT 1996

>gb|T76642|T76642 11420 Arabidopsis thaliana cDNA clone 146I16T7.
            Length = 543

  Plus Strand HSPs:

 Score = 576 (159.2 bits), Expect = 1.6e-37, P = 1.6e-37
 Identities = 140/171 (81%), Positives = 140/171 (81%), Strand = Plus / Plus

Query: 29826 TGCAGTTTCAATCACAATCCGTATAGTGATGGGATTTATGCTTCTTGCACTCATATGGAA 29885
             |||||| ||||||||||||||||| ||| | || || |||||| ||||  | |||||| |
Sbjct:     1 TGCAGTCTCAATCACAATCCGTATTGTGTTTGGTTTCATGCTTATTGCTTTGATATGGGA 60

Query: 29886 GTTTGACTTCTCACCATTCATGGTCTTGATCGTTGCTATCCTGAATGATGGTACTATCAT 29945
              |||||||||||| | ||||||||  ||||  |||| ||||| |||||||||||||||||
Sbjct:    61 ATTTGACTTCTCAGCGTTCATGGTTCTGATTATTGCCATCCTTAATGATGGTACTATCAT 120

Query: 29946 GACGATATCAAAGGACAGAGTAAAGCCTTCTCCACTTCCTGATTCATGGAA 29996
             ||| || |||||||||||||| ||||| |||||    ||||||   |||||
Sbjct:   121 GACAATCTCAAAGGACAGAGTCAAGCCATCTCCCACACCTGATAGCTGGAA 171



BLASTN Tue Apr 9 16:03:17 EDT 1996

>gb|T76642|T76642 11420 Arabidopsis thaliana cDNA clone 146I16T7.
            Length = 543

  Plus Strand HSPs:

 Score = 260 (71.8 bits), Expect = 1.6e-24, Sum P(2) = 1.6e-24
 Identities = 72/97 (74%), Positives = 72/97 (74%), Strand = Plus / Plus

Query: 30173 GGCAAAGTTTGGGGTGAGATCTATCAGTGGAAATCCGCATGAGCTAACAGCAGCTGTTTA 30232
             ||  ||||| || ||||| || ||||| |  |||    |||| ||||  |  ||||| ||
Sbjct:   270 GGACAAGTTCGGTGTGAGGTCAATCAGGGACAATAACGATGAACTAATGGGTGCTGTGTA 329

Query: 30233 CCTACAAGTTAGTATCGTGAGCCAAGCGCTTATCTTT 30269
              ||||||||||||||| | || ||||| || ||||||
Sbjct:   330 TCTACAAGTTAGTATCATCAGTCAAGCTCTAATCTTT 366

 Score = 242 (66.9 bits), Expect = 1.6e-24, Sum P(2) = 1.6e-24
 Identities = 70/97 (72%), Positives = 70/97 (72%), Strand = Plus / Plus

Query: 30001 AAAGAGATATTTGCCACCGGCGTTGTTCTTGGCACTTACCTAGCAGTCATGACTGTAGTT 30060
             ||||| || || ||||| ||  |||| || ||    |||| |||  | |||| |||  ||
Sbjct:   175 AAAGAAATTTTCGCCACTGGAATTGTGCTGGGAGGCTACCAAGCCATTATGAGTGTTATT 234

Query: 30061 TTCTTCTGGGCTGCAGAGAGCACTGACTTCTTCTCTG 30097
             ||||||||||||||  | |  || ||||| ||||| |
Sbjct:   235 TTCTTCTGGGCTGCTCACAAGACCGACTTTTTCTCGG 271